Search on : Sequences

 


 
 AY526233
   


Sequence

ccgaaagggtagacctcccacccttgtgtattattactttgttgctttggcgaacctcag
ggctcgccagaggatataaaactctttttattaatgtcgtccgagtactatataatagtt
aaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcga
taagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccc
cttggtattccggggggcatgcctgttcgagcgtcatttcaaccctcaagctcagcttgg
tattgagcccatgtcagcaatgacaggctctaaaatcagtggcggcgccgctgggtcctg
aacgtagtaataactctcgttacaggttctcggtgtgcttctgccaaaacccaaattttt
ctatggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataag


Show reverse-complement sequence

Basics statistics(Total length: 477)
Sequence ChartSequence Chart
Genbank URL:
 
Organism:Ciboria batschiana 
Definition:Ciboria batschiana strain CBS 331.35 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. 
Genbank accession number:AY526233