Search on : Sequences

 


 
 FJ240301
   


Sequence

tcgtcgtcatcggccacgtcgactctggcaagtcgaccactgtgagtatcaccgcatccc
aaccccgccgacacttggcggggtagtttcaaatttccaatgtgctgacatactttgata
gaccggtcacttgatctaccagtgcggtggtatcgacaagcgaaccatcgagaagttcga
gaaggttggtctcattttcctcgatcgcgcgcccttttccctttcgaaatatcattcgaa
tcgcactcacacgacgactcgatacgcgcctgttaccccgctcgaggtcaaaaattttgc
ggctttgtcgtaatttttttctggtggggctcataccccgccactcgagcgacaggcgtt
tgccctcttcccacaaacctttccctgggcgctcatcatcacgtgtcaaccagccactaa
ccacctgtcaataggaagccgccgagctcggtaagggttccttcaagtacgcctgggttc
ttgacaagctcaaagccgagcgtgagcgtggtatcaccattgatatcgccctctggaagt
tcgagactcctcgctactatgtcaccgtcattggtatgttgtcaccactgctgtcatcac
attctcatactaacatggctatcagacgctcccggtcaccgtg


Show reverse-complement sequence

Basics statistics(Total length: 643)
Sequence ChartSequence Chart
Genbank URL:
 
Organism:Fusarium sp. NRRL 45681 
Definition:Fusarium sp. NRRL 45681 translation elongation factor 1-alpha (EF1) gene, partial cds 
Authors:O'Donnell,K.; Ward,T.J.; Aberra,D.; Kistler,H.C.; Aoki,T.; Orwig,N.; Kimura,M.; Bjornstad,S.; Klemsdal,S.S. 
Genbank accession number:FJ240301