Search on : Sequences

 


 
 FJ240312
   


Sequence

tcgtaacaaggtctccgttggtgaaccagcggagggatcattaccgagtttacaactccc
aaacccctgtgaacataccttatgttgcctcggcggatcagcccgcgccccgtaaaaagg
gacggcccgccgcaggaaccctaaactctgtttttagtggaacttctgagtataaaaaac
aaataaatcaaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagc
aaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcac
attgcgcccgccagtattctggcgggcatgcctgttcgagcgtcatttcaaccctcaagc
ccagcttggtgttgggagctgcagtcctgctgcactccccaaatacattggcggtcacgt
cgagcttccatagcgtagtaatttacacatcgttactggtaatcgtcgcggccacgccgt
taaaccccaacttctgaatgttgacctcggatcaggtaggaatacccgctgaacttaagc
atatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtgaagc
ggcaacagctcaaatttgaaatctggctttcgggcccgagttgtaatttgtagaggatga
ttttgatgcggtgccttccgagttccctggaacgggacgccatagagggtgagagccccg
tctggttggatgccaaatctctgtaaatctccttcgacgagtcgagtagtttgggaatgc
tgctctaaatgggaggtatatgtcttctaaagctaaataccggccagagaccgatagcgc
acaagtagagtgatcgaaagatgaaaagcactttgaaaagagagttaaaaagtacgtgaa
attgttgaaagggaagcgtttatgaccagacttgggcttggttaatcatctggggttctc
tccagtgcacttttccagtccaggccagcatcagttttcgccgggggataaaggcttcgg
gaatgtggctcccctcggggagtgttatagcccgttgtgtaataccctggtggggactga
ggttcgcgcttctgcaaggatgctggcgtaatggtcatcaacgacccgtct


Show reverse-complement sequence

Basics statistics(Total length: 1131)
Sequence ChartSequence Chart
Genbank URL:
 
Organism:Fusarium sp. NRRL 45681 
Definition:Fusarium sp. NRRL 45681 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence 
Authors:O'Donnell,K.; Ward,T.J.; Aberra,D.; Kistler,H.C.; Aoki,T.; Orwig,N.; Kimura,M.; Bjornstad,S.; Klemsdal,S.S. 
Genbank accession number:FJ240312