Search on : Sequences

 


   


Sequence

atcattaccgagtttacaactcccaaacccctgtgaacataccttatgttgcctcggcgg
atcagcccgcgccccgtaaaaagggacggcccgccgcaggaaccctaaactctgttttta
gtggaacttctgagtataaaaaacaaataaatcaaaactttcaacaacggatctcttggt
tctggcatcgatgaagaacgcagcaaaatgcgataagtaatgtgaattgcagaattcagt
gaatcatcgaatctttgaacgcacattgcgcccgccagtattctggcgggcatgcctgtt
cgagcgtcatttcaaccctcaagcccagcttggtgttgggagctgcagtcctgctgcact
ccccaaatacattggcggtcacgtcgagcttccatagcgtagtaatttacacatcgttac
tggtaatcgtcgcggccacgccgttaaaccccaacttctgaatggttgacc


Show reverse-complement sequence

Basics statistics(Total length: 471)
Sequence ChartSequence Chart
Sequence depositor:Gerard, 1/9/2010 
CBS group:
Applied and industrial mycology ?
Collection yes
Yeast and basidiomycete research ?
Physiology and ecology of fungi ?
 
Evolutionary phytopathology ?
Origins of pathogenicity in clinical fungi ?
Bioinformatics ?
   
 
CBS strain data:
 
Remarks:Data from Geert and Gerard 
Organism:Fusarium ussurianum 
Definition:Fusarium ussurianum CBS123752 D-01644 ITS 
Strain name:CBS 123752 
Other associated files:
  • rdna123752S10072PITS4.ab1
 
DNA extract number:exD01644 
Region:ITS 
Genbank ID:KBUW01021342 
Genbank accession number:MH863322.1