Search on : Sequences

 


   


Sequence

gcatatcaataagcggaggaaaagaaaccaacagggattacctcagtaacggcgagtgaa
gcggtaaaagctcaaatttgaaatctggctcttttagagtccgagttgtaatttgtagaa
gatgcttcgggtgtggttccggtctaagttccttggaacaggacgtcatagagggtgaga
atcccgtatgtgactggatacctatgctcatgtgaagctctttcgacgagtcgagttgtt
tgggaatgcagctcaaaatgggtggtatatttcatctaaagctaaatattggccagagac
cgatagcgcacaagtagagtgatcgaaagatgaaaagcactttggaaagagagttaaaca
gtacgtgaaattgttgaaagggaagcgcttgcaatcagacttgcacttggtgttcatcgg
ggtctcgtgccccgtgtacttcatcaagttcaggccagcatcagtttgggtggttagata
aaggcttagggaatgtggctttcttcgggaagtgttatagccctaggtgcaatgtagcct
acctggactgaggaccgcgcttcggctaggatgctggcgtaatggttgtaagcgacccgt
cttgaaacacggaccaaggagtgtacctaatatgcgagtgtttgggtgttaaacccatac
gcgtaatgaaagtgaacgctggtgagaacccttaagggtgcatcatcgaccgatcttgat
gtcttcggatggatttgagtaagagcatattgggtgcgacccgaaagatgagtgaactat
acgtgaatagggtgaagccagaggaaactctggtggaggctcgcagcggttctgacgtgc
aaatcgatcgtcaaatttgcgtataggggcgaaagactaatcgaaccatctagtagctgg
ttcctgccgaa


Show reverse-complement sequence

Basics statistics(Total length: 911)
Sequence ChartSequence Chart
Sequence depositor:an 
CBS group:
Applied and industrial mycology ?
Collection yes
Yeast and basidiomycete research ?
Physiology and ecology of fungi ?
 
Evolutionary phytopathology ?
Origins of pathogenicity in clinical fungi ?
Bioinformatics ?
   
 
CBS strain data:
 
Organism:Sclerotinia pseudotuberosa 
Definition:Sclerotinia pseudotuberosa CBS 331.35 ex29085 LSU 
Strain name:CBS 331.35 
Contigs:
  • 36457_ex29085_LR0R_G7_051.abiv
 
Other associated files:
  • 36457_ex29085_LR0R_G7_051.ab1
  • 36553_ex29085_LR5_G7_051.ab1
 
DNA extract number:ex29085 
Region:LSU 
Genbank ID:KBUW01001111 
Genbank accession number:MH867209.1