Search on : Sequences

 


   


Sequence

gcatatcaataagcggaggaaaagaaaccaacagggattgccctagtaacggcgagtgaa
gcggcaacagctcaaatttgaaatctggctttcgggcccgagttgtaatttgtagaggat
gattttgatgcggtgccttccgagttccctggaacgggacgccatagagggtgagagccc
cgtctggttggatgccaaatctctgtaaatctccttcgacgagtcgagtagtttgggaat
gctgctctaaatgggaggtatatgtcttctaaagctaaataccggccagagaccgatagc
gcacaagtagagtgatcgaaagatgaaaagcactttgaaaagagagttaaaaagtacgtg
aaattgttgaaagggaagcgtttatgaccagacttgggcttggttaatcatctggggttc
tctccagtgcacttttccagtccaggccagcatcagttttcgccgggggataaaggcttc
gggaatgtggctcccctcggggagtgttatagcccgttgtgtaataccctggtggggact
gaggttcgcgcttctgcaaggatgctggcgtaatggtcatcaacgacccgtcttgaaaca
cggaccaaggagtcgtcttcgtatgcgagtgttcgggtgtcaaacccctacgcgtaatga
aagtgaacgcaggtgagagcttcggcgcatcatcgaccgatcctgatgttctcggatgga
tttgagtaagagcatacggggccggacccgaaagaaggtgaactatgcctgtgtagggtg
aagccagaggaaactctggtggaggctcgcagcggttctgacgtgcaaatcgatcgtcaa
acatgggcatgggggcgaaagactaatcgaaccttctagtagctggtttccgcga


Show reverse-complement sequence

Basics statistics(Total length: 895)
Sequence ChartSequence Chart
Sequence depositor:an 
CBS group:
Applied and industrial mycology ?
Collection yes
Yeast and basidiomycete research ?
Physiology and ecology of fungi ?
 
Evolutionary phytopathology ?
Origins of pathogenicity in clinical fungi ?
Bioinformatics ?
   
 
CBS strain data:
 
Definition: CBS 123752 exD01644 LSU 
Strain name:CBS 123752 
Contigs:
  • 55069_exD01644_LR0R_D6_D06.abiv
 
Other associated files:
  • 55069_exD01644_LR0R_D6_D06.ab1
  • 55165_exD01644_LR5_D6_D06.ab1
 
DNA extract number:exD01644 
Region:LSU 
Genbank ID:KBUW01008756 
Genbank accession number:MH874854.1