Search on : Sequences

 


   


Sequence

gtaacaaggtctccgttggtgaaccagcggagggatcattacagagttatcaaaactccc
aaaacccatgtgaacatacctcgcgttgcctcggcaggtggcgccccgccctgtgaggac
ctaccctgtaggagctcacccggtggtcgcccctgccgacggcccacgaaactctgtttt
ttatagcattagacctctgaaaagataactaaataagttaaaactttcaacaacggatct
cttggttctggcatcgatgaagaacgcagcgaaatgcgataagtaatgtgaattgcagaa
ttcagtgaatcatcgaatctttgaacgcacattgcgcccaccagtattctggtgggcatg
cctgttcgagcgtcatttcaacccttaagcccctgttgcttagcgttgggagcctaccgg
aaaccgtccggtagctccccaaagtcagtggcggagccggttcgcactccagacgtagta
gcttttacacgtcgcctgtagcgcgggccggtcccctgccgtaaaacccccaaattctta
taggttgacctcggatcaggtaggaatacccgctgaacttaagcatatcaa


Show reverse-complement sequence

Basics statistics(Total length: 591)
Sequence ChartSequence Chart
Quality:check 
Sequence depositor:an 
CBS group:
Applied and industrial mycology ?
Collection yes
Yeast and basidiomycete research ?
Physiology and ecology of fungi ?
 
Evolutionary phytopathology ?
Origins of pathogenicity in clinical fungi ?
Bioinformatics ?
   
 
CBS strain data:
 
Organism:Nemania serpens var. serpens 
Definition:Nemania serpens var. serpens CBS 659.70 ex51265 ITS 
Strain name:CBS 659.70 
Contigs:
  • 128998_ex51265_ITS5_F3_F03.abiv
 
Other associated files:
  • 128998_ex51265_ITS5_F3_F03.ab1
  • 129094_ex51265_ITS4_F3_F03.ab1
 
DNA extract number:ex51265 
Region:ITS 
Genbank ID:KBUW01017910 
Genbank accession number:MH859890.1