• COLLECTIONS HOME
  • SEARCHToggle
    • Fungi & Yeasts Collection
    • -
    • NCCB bacterial collection and Actinomycetes strains
    • NCCB plasmids and phages collection
    • -
    • Fungal taxonomy (Mycobank)
    • Media for fungi
    • Yeast methods
    • Fungi & Yeasts bibliography
    • -
    • Bacterial taxonomy
    • Media for bacteria
  • MORE DATABASEToggle
    • Aspergillus and Penicillium
    • Ceratocystis (Q-bank)
    • Colletotrichum (Q-bank)
    • Dermatophytes
    • Fusarium MLST
    • Indoor fungi
    • Medical fungi
    • Monilinia (Q-bank)
    • Mycosphaerella
    • Mycosphaerella (Q-bank)
    • Penicillium subgenus Penicillium
    • Phaeoacremonium
    • Phoma (Q-bank)
    • Phytophthora (Q-bank)
    • Pseudallescheria/Scedosporium
    • Resupinate Russulales
    • Russula
    • Stenocarpella (Q-bank)
    • Yeasts speciesToggle
      • Yeasts species 2001
      • Yeasts species 2011
  • IDENTIFICATIONToggle
    • Pairwise sequence alignment
    • Polyphasic identificationToggle
      • Yeasts species 2001
      • Yeasts species 2011
  • ORDER & DEPOSITToggle
    • Deposition of cultures in the public collections
    • Deposition of cultures in the restricted collection
    • The Netherlands Culture Collection of Bacteria
    • Access to the collections and facilities
    • International collaboration
    • Ordering cultures
    • Prices
  • LOGIN
  • CONTACT US
  • Unknown user
  • Cart IconToggle
    • No items in cart
{1}
##LOC[OK]##
{1}
##LOC[OK]## ##LOC[Cancel]##
{1}
##LOC[OK]## ##LOC[Cancel]##
RadDatePicker
RadDatePicker
Open the calendar popup.
Calendar
Title and navigation
Title and navigation
<<<December 2019><<
December 2019
 SMTWTFS
4824252627282930
491234567
50891011121314
5115161718192021
5222232425262728
532930311234
Search on : Sequences
  • Add condition
    • Any text field
    • Record Id
    • Sequence title
    • Sequence
    • Editing state
    • Quality
    • Sequence depositor
    • CBS group
    • CBS strain data
    • Genbank URL
    • Remarks
    • Organism
    • Definition
    • Authors
    • Strain name
    • Contigs
    • Other associated files
    • DNA extract number
    • Lims results
    • Lims Extraction ID
    • Region
    • Privacy
    • Genbank ID
    • Genbank accession number
  • Match on: All conditions
    • Any condition(s)
    • All condition(s)
  • Reset base condition(s)
  • Switch to: Advanced Search
  • Search

Search on : Sequences
  • Add condition
    • Sequence
    • Editing state
    • Quality
    • Sequence depositor
    • CBS group
    • CBS strain data
    • Genbank URL
    • Remarks
    • Organism
    • Definition
    • Authors
    • Strain name
    • Contigs
    • Other associated files
    • DNA extract number
    • Lims results
    • Lims Extraction ID
    • Region
    • Privacy
    • Genbank ID
    • Genbank accession number
  • Match on: All conditions
    • Any condition(s)
    • All condition(s)
  • Reset base condition(s)
  • Switch to: Advanced Search
  • Search
  • Click me to open a help window on this menu 
 
  • Search conditions (click to expand)
       
     
    Any text field (C_1)
    select
    • Contains
    • Starts with ...
    • Matches exactly
    • Value is undefined
     
       

  • Export data
    • Export to Excel
    • Export to Word
 


 
 D45087 - IFO 1679* - Metschnikowia reukaufii 26S rRNA partial sequence.
   


Sequence

ggccagcatcggagtggggggagacaaaaaagaaaaggaatgtatcctttcgagtattat
agcctaattcgaatatctccacccccttccgaggcctgcgattctatcaaggatctggcg
taat


Show reverse-complement sequence

Basics statistics(Total length: 124)
Sequence ChartSequence Chart
Correspondence

Visiting address:
Uppsalalaan 8
3584 CT, Utrecht
The Netherlands

Phone: +31 (0)30 21 22 600
Fax: +31 (0)30 21 22 601
info@wi.knaw.nl

Contact our curators

Filamentous Fungi:
Dr. Gerard Verkleij
g.verkleij@wi.knaw.nl

Yeasts:
Dr. Marizeth Groenewald
m.groenewald@wi.knaw.nl

Bacteria:
Mrs. Marian Figge
NCCB@wi.knaw.nl

Sales

Ordering Strains:
Sales department
sales@wi.knaw.nl

Restricted collections (Budapest Treaty & safe deposits):
Mrs. Francis Claus (sales)
f.claus@wi.knaw.nl

Ordering Books, Journals & information on Courses:
info@wi.knaw.nl

Identification:
identification@wi.knaw.nl

Shortcuts

Home
Collections
Courses
Subscribe to our newsletter
Newsletter Archive
Privacy statement





© Copyright 2019 Westerdijk Fungal Biodiversity Institute. Website built using BioloMICS Software.
× Cookies
Cookies are small text files that contain a string of characters and uniquely identifies a browser. They are sent to a computer by website operators or third parties. Most browsers are initially set up to accept cookies, since this is required by most website owners in order to access their sites. You may be, however, able to change your browser settings to cause your browser to refuse cookies in general, block third party cookies or to indicate when a cookie is being sent. 

If you would like to know more about cookies and how they work, please visit www.allaboutcookies.org.

We use cookies in a very limited number of scenarios that are all present to help the users to have an easier experience. List of cookies present on a website managed by BioloMICS:

1. Table-columns-strains_2: contains the list of columns that must be displayed (when changed by the end-user) when searching Strains_2 table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
2. Queries-layout-strains_2: contains the list of queries that have been done by the end-user when searching Strains_2 table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
3. Table-columns- strains_3: contains the list of columns that must be displayed (when changed by the end-user) when searching strains_3 table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
4. Queries-layout- strains_3: contains the list of queries that have been done by the end-user when searching strains_3 table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
5. Table-columns-Open%20collection: contains the list of columns that must be displayed (when changed by the end-user) when searching 20collection table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
6. Queries-layout- 20collection: contains the list of queries that have been done by the end-user when searching 20collection table views (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
7. List-display: keeps the end-user preference in terms of display format (either results in grid or results looking like a Google format) (this is there to keep the preferences of the end-users; It will not be present if the end-user has not changed this option).
8. SearchState: this keeps the information about the last query and the page number where the end-user was the last time he/she did a query.
9. ASP.NET_SessionId: this is an automatic cookie that keeps the unique session ID number to be used on the server side. This is deleted when session is finished/expired.
10. last-query-layout-Open%20collection and similar, contain the last query done by the end-user on the Open%20collection table view. This is used when first reloading the page. It is replaced each time there is a query done.
11. _utma, _utmb, _utmc, _utmd, etc are Google analytics cookies to analyze web traffic (see https://helpful.knobs-dials.com/index.php/Utma,_utmb,_utmz_cookies).
Cookies mentioned in the last point are Google analytics cookies that are IP anonymized which means that we cannot trace single users. See below for more information. 

No other cookies than the ones mentioned above are used on our websites.

Google cookies and technologies
Google Analytics: These cookies allow us to see information on user website activities including, but not limited to page views, source and time spent on a website. The information is depersonalized and is displayed as numbers, meaning it cannot be traced back to individuals. This will help to protect your privacy. Using Google Analytics, we can see what content is popular on our websites.

You can prevent the information generated by the Google cookie about your use of our Sites from being collected and processed by Google in the future by downloading and installing Google Analytics Opt-out Browser Add-on for your current web browser. This Add-on is available at http://tools.google.com/dlpage/gaoptout.