Search on : Sequences

 


   


Sequence (reverse)

aaaacataccaactaactgataaaagagctcattaaccgatctgggactcactaataacc
ttgggcctccaaaccataccgggactattggccaataatccatggctgctaccatcccaa
gccattatttatatacacataaggggtaattaggtatttatatatgaaacgtattacagt
gttgaagcaggcctgtatcagctcaagtacatacagtacaattgtactgtacagtactgc
aattttaaggcatggttcttgcatgcagtgagaaagttacgagtaaatactgtatatgta
tcatctcgctcatccttaaataatcaattactatatactaaaattcaaactcatttcgga
actggttgacgtccattccgtttccaaccttggccaccagatctcgtcggtccataccca
ggaaaactcgcttcagggtatcgtacaggttagtggactggttggccaaaacatcatcct
ggactccctcaaccttgtgcatggacagagcccccagaagatactgggcagcctccttgt
agcagccaatgttaatgcacgacacaccaaggttgtatcgagcacgcacaaaagagggac
gcagctcgagagctttgtagtaagcatcaatggcctcctcagatcggtgggagttggcaa
gggtggctccgagtctattccacagaagagcatcatcgggtcgaacagcaatggcggcgt
tgaaacagtcaatggccttatcgtattcctcgtttccgtagaacagaacaccgagaccaa
cttggacatcagcgtcaatgttagctccgtcaggggacagttgggcagctcggataaaca
gctcagtgacccgagagtgcagctggaacttatcctcgttgccgagtcgaggctcctggt
ttcgggcctggtccacaacctcggggtacttggtggcaagccatcgctccagagtagcat
atgcggcattctcgtatccttcgttggtgtaagaaacagacaagttcatcagagcagaaa
ggttaccaggctccagcttgatgcatcgttccagagctcggatagcagggtcctcctttt
cattctgggcctggcaggctccaagtcgtccccaagcctcggcgtgctcagtgttcttct
gaacagctgcctcgaaggccagagcagcctccgaaagtcgaccgccagtctccatgagct
cgactccaatcttgaagggatcagggtgctccatgaactggttgttctcctcgaactggt
agtcggcaaactcaggccggttgtgggtatactcatggaagtctcgctcccacgcgggcg
agttggtctcctccagccactcgtccatgttgtcgagaacgttgacctggaggttcttcc
agatgttttcaaagtccatgttcttgatatccatgggcttgtcctcagtagtggtttcag
tctcggtgacagtctcggtggcagtagcagtctcggcagtctgctcctcgacctccttac
ccttgccaacggcagagtccatctgcttgaactgctcctcccagttctgctcgtccagct
cgacaactcgtgcgttagcctgctggggctggaactgaggagccatgttggcactcattc
cagagtacatgggacgagccatgccgtacatgggcattccccccatacccatgccgcctt
gcatggggccgggaccctgctgttgcatggcctctgcaggagatcctcctcgctggaact
cggcgttccagttcttggcgtcctggggagcagcgccgggagcggtctgttgtcctccaa
agtctcgggcccactgtcctccgttagcagcgccctgctggctgggaacctggggaatct
ggcctccttgggcacccatgttgtggagctcatgtcgcatctgctcgtagttgaaagacg
actgctcgggtccggcagcaccgaatcgcgccatcatctctcggtcctgctgtgacatct
cgccagtgttggatcgcatgcctccaactcggcccccagagggacccgccacccgatcat
gctggagggatcggtcctcagcggtgtgtttggtgaactggctcagggggtttctgcccg
tagagcattcgcttcctcctctcataaacgacataatgatgtttcctgcttgctttggtg
gtctctgtgtgtgctgtgtgcaagaaaagtggttggcaagagtcacagtttagttatttc
agtccaaaggaaatcatgtgtaatatgcaagtctatagttctctgctggcagtcactgca
gtaacattaaggttcccccacgactgagtgcccttacccttgttgaatggggtatctggg
gaatttgagccgaggcataaggccacgtgcgcaacgtggattcagtggcgactgcacaga
gtggtactctgcgccaatctcatcatattgagatccttaaagttttgtctttcacgcccc
tattaccccacaatctgacgacttcgaatacactcaatttttcacgttggcctgttccaa
aagtttcttactaacgaagccagagcagttgggggataaggttgcaactaccgcgctgg


Show original sequence

Basics statistics(Total length: 2579)
Sequence ChartSequence Chart