Search on : Sequences

 


   


Sequence

gacccgggactagtcatgggtgaaggtatgaacctagttgatccatcatcaggggaatcc
gtcttgggctctctgaaccgacgattggtgaaccattgtgtaacctgatgaagtgagatt
ccacaatgctctccaataattctcctctctgttctggttggatgagaacagatcttgaac
agagagtcaagataggcggtaacctcgttacttaacctattccggactttcttaggaaag
acgtcacagttgtgatccagactctgcaacttgtcagcttcttttagagctctggctttg
acttcgaggtctttggtgctggcctcataggctctgatttcgcctctatgtctttgtcta
aatttgctgcgacctctagatagtcatcaagcagctctgcggcaattccttttgcaagac
tgtactcatcattccaatcagcacccagtatggccttactggtcatccattcgttctgtt
ttagtattccccaatactgctcttgttttcaatatactcactaatctcgctggtaccagt
tgctggatgtaagtgatgtagtggcgaatcagcctgtcgtatttgattctgtgttcattt
ggaacaccctccaaaaaggtccaaatcgttgtgcttatgtagagtccactctcagggaat
ttggacatccactcagaaatctcttcaaaccatttaagggaactggagatttcgattgac
tgttcgtgaagggcctggcacgtggtttcgccttttcttgcggccaagatcaggcgctgg
cagcgccagatatctgtaggggttcggctaggcatgtgatgtggggagaaaaaaaatgtc
gtatctgtttaattaagtaccagggtgtacttggtggggccggtttctagatatatattt
acaatggtcacttggactggtcagacgaggtggatgtggctagtttaccccgatattatt
catgcacgccgtgcatatggttctggaacaaagacaccttaagcgacattggctcttgcc
tcatcacaattgcctaaactagagatctagtatttccagaccaacacatatcgacaaata
tatataaacaacatgcaactctcttggctggctattatcagctataccaagccacacata
acatcctcaaaatggaaaacacgatactacacattcattcctttcaactaccccaaacag
aacagccctaccccgaggctatgttattcgacagggacactagcgattcacgtacggttc
taactcagaagccaaatggactggaaatatcactcaactttttgcaatatgacggtcaca
aggggctgttcatcaggcaagacagtcgaacgaatgagcctgagtacattgaacccaaag
ttctgaaacctaggaacagctacatcttgttccgaaatgcaacatccagatgctctcaga
gcattgatcccaactcagcatttgtttcgagggtctccagttatatctggggctcgggaa
tccccaatcctattgttcggcgatggttcaagtatatgggtttcttcgaagccctatacc
acgaagtcgactatcctgagtatatcccgaacaaactgcccaagtccccaaagaagccga
aggtccagaagggtgcaactaagtctaagaaaaagggagcaaagggtaagaacaaggtta
ctgctctccaagtactggtcggccctaccgttggtgtcgggggaaggatgactgttagcc
caatgactgctttctttagcaacaactctcacgttacgtgctatgaccccaactttgttc
tcgatacacctactcgagaattcctcatgatgcccctggatgatatcactctcccatcgc
aaggaccaagatcagattcacaggagcagcacgtccctcggcagcctcccgatgggcagg
actattttgacattctggatattgatgatttcgtttctccttatgatgacttgactactc
gctcgttcaccaacaggcagctttttaagcatgccacactgggttgagcttggtaatttt
ctgtactcactgtacgtttatcattggacacactaacggtattataatttaattttattt
ccactgaaagaagttacatctggcactggt


Show reverse-complement sequence

Basics statistics(Total length: 2130)
Sequence ChartSequence Chart