Search on : Sequences

 


   


Sequence

cccgggctaatttggtagcggtgactctagcctggtgatgacgcaaaaaaatggcggcaa
aatgagcaatgtatcggccaccttttgtgccaaacatgttcaacacggtcgtctccaact
atctctccaccaagtccttcagtaaccttgagaccagccacgcgaaattggggggcctcc
cggtcagctacacagtaatgtaattagttgtgtggggttagggtgtgtggggacacaaac
acaagtcgcaaatatatatagaccggggagcgaccgcccatttccaccttattttttttc
ccgctcttttcctccgttgctggcaccgcctgtcgtctcacgtgcacaagctggggttgg
gcggggggaaagtgttcaagggtgcggtgcttaaccacgtcgttgtgattgtagtttggg
ctccccctactacacctcccacacacacgttttattatggcctgtcccgtttaggaaacc
atactatggctctggaatgtacacaaggtttcctccacagaaatgtgcagttggacccaa
ccaaacgagcccgttcgagcccgtcctaagacgcgcaaaaaaacacacacacaagaaaaa
tcaacgcatttccgcccccgtgcgtcttctcgtctcccccaccaccccattcgtgacgtg
ttgtctaacaacacaacaacaaaaaataaaaaacaacatcagcatttttattttttttgc
caccttatccacgtgcgaaccttattgggaaaaattttcacacgccgcctgcctcccgca
gtccctcacaaatactgactgcagggtaacggtgccttccccatttaagtttcatttcgc
ccccgactcaaactcccaacttacccggtcgtgatacccacagaggactggcagtccgac
taattagtggcaacggcggcgataaaaaacgacaacgacaagccacaaaccgcctacaga
agccccgatatagacggccgtaacgtgatgcactccgacgcgcccacgcccgtggccaac
gagctgtctgaggtgtcgcatctggcagagggcgacaacgcgagcttttcggcgggcaac
ttcaccgttctacagctcccatcggacccctcccattgcattgattatgctattccagca
ggcaccctggtgatagtggatcccaacaaccccgacaacaaccgcacggttaagttgcaa
gcgccggcggttttccggccccagtgtgctctgggaggaactcgagctccggccccaaga
ccagaggagtcgtttccagactggagcgaataccaaaagtaccatcataacgaccgacga
gacccattctacggctcggtcacgcccatcgcttataccattgcggcgtccacagtcaca
gcttggatgctgctgatcattctgtttctgtcgagaaaaccgtctcctctgtttcagaag
attgcggtgctgattacggcggtttcgctgaccgtttttctggcgcaggccacagatacc
ctggaatcgcaatacaatgaaggataccagaatgcatacgaactacgacacaaaatcatg
ggaggatgggcatttcgaattctgcaggtgatcacatgtgtcatcacctggctggcccgt
ttgcaagtcgtgattcggctgtttgacgtgcccaaaatcaacactcgattggcagttgtg
gggtccacgttgattttcaccaatgccaccatctgggcgtgtctgaacttcattcccccg
tggtcgcagtacgttcgaaatgccaagtcggtgcttccagtgtttggagctctgtgttcg
cttcttctcgaggtgttttatctcgtggtggttgtcatctactccatttccaaacgcaaa
tacgcatactctcgcacgtctatagttatggccgccatctcgtggttggccatgatcctg
cccatggtctttatcgtgtttgatattgctcattactggattgcaggctggtcagacttc
attcggtggacggctgacgctgctgcctcggtagtagtgtgggaatggaccaatgtgatt
gtgtaccaggagcgaagagagcaacgacaatcagtcctgggccgtcaggtgtatagagac
gagattctggactttaagggcgacaacggaggaggaacagttggaggagggcgaacaaag
tatccttctcgcatggaggaagacgacgttcctttcagatcgtctcccaacgaccaccac
tttacttccaacattcctacttctgctggcgagggacagtcgttccagttcttcaaacgg
gccagattgcccatgtactctcgcaagatttggaaaattgctcgaggagagtctgcagct
agtaacaacacccattacgagcacgccatcattgaggaagaggaggaggagtccattgaa
cgaaacagacggactcccactgttcaggagaatggagaggaggacgacgaggagacttat
gacgaagagaatgaccagtacagccaggacaaccattcgtctgtgcattcctttgagtcc
agtcgaccttcccagcacccagttccttcctccggaggcactcgggctgtgggacacacg
cattttcctcttcccggccagtccgagggagcaaacactacttctcctgctgctgctgct
gctgctgcagaacctgaacctgaacccgtggctggtccttcagggggagctgctgcccat
ggagactcggatgacgactcggacaactcggacgactcttctctggcgtccttcaccgtg
attcagcagactggcttctcagtcgacaatcagggagtacccgagtacgacgcagactct
gctcctcccacttttgaacccattcctggcttccatcgccaggattactcggatgcaaag
ggataggagacctatttatatattaacgataatgatttatgacattggactttacgatag
gcgaggcgatgagggtgcttgcgtgtatcgccgagataatgtgaagttacttgtcactta
agccatgctcattgtagcgagatacagtaggatgtttgtgagcttcatttaccatcctct
tcaaattctcatgactcaactctttgaatcatgtagatcgaaggcagtcagttcaatgtt
acattgtctataacttgctgaatgatccagttgaagactccaatcaagtctcatacgaaa
ctagagtggttttatcacaccgagttgtctttattccgccgttgaaacgatatctataaa
ttcacagctcgtaaaccaatccactatggataaatcacaactgggcacatcttcaacgtc
gacaacgacaaagataatgaatggtattggattggaagcatgaacatatagccgtactcc
agaaataaccgccccaaactgcttccatctccccatctccacatctaaccccagggtttt
ccaaaaaaaaatttggttttaccattttttattcaatcacgtgacttgtatcactttact
tgtgtctccaacgccgttgacaaattaaccttcgtcccctatagctcagttggtagagcg
ttcggcttttagtaaccctaaaggcatggtaaccgaaatgtccagggttcgagcccctgt
gggggagttaacattgttaatttcctttttgtttttttttggtgtttttcttttgttttt
gtttctcctcgccttggataaaaattgtgcactggttttagccccctttcataagtacag
taccggtacattgtgctggaagttgtagccatgtcagataaaaatgttgtttaaattgct
caccaaaaaagtggagtcatattctgagatgttttgggcagtttttcgcacggaaaaagt
tgaaaatcagatc


Show reverse-complement sequence

Basics statistics(Total length: 3853)
Sequence ChartSequence Chart