Search on : Sequences

 


   


Sequence

ccgaaagggtagacctcccacccttgtgtattattactttgttgctttggcgaacctcag
ggctcgccagaggatataaaactctttttattaatgtcgtccgagtactatataatagtt
aaaactttcaacaacggatctcttggttctggcatcgatgaagaacgcagcgaaatgcga
taagtaatgtgaattgcagaattcagtgaatcatcgaatctttgaacgcacattgcgccc
cttggtattccggggggcatgcctgttcgagcgtcatttcaaccctcaagctcagcttgg
tattgagcccatgtcagcaatgacaggctctaaaatcagtggcggcgccgctgggtcctg
aacgtagtaataactctcgttacaggttctcggtgtgcttctgccaaaacccaaattttt
ctatggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataag


Show reverse-complement sequence

Basics statistics(Total length: 477)
Sequence ChartSequence Chart
Genbank URL:
 
Remarks:CBS 331.35 
Genbank accession number:AY526233